Pedido rápido

Text Size:AAA

Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse IL5 Información de producto de clon de cDNA
Tamaño de cDNA:402bp
Descripción de cDNA:Full length Clone DNA of Mus musculus interleukin 5 with N terminal Flag tag.
Sinónimo de gen:IL-5
Sitio de restricción:KpnI + XbaI (6kb + 0.43kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL5 Gene Plasmid Map
Mouse IL5 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51068-ACG$225
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51068-ACR$225
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51068-CF$195
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51068-CH$195
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51068-CM$195
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51068-CY$195
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(Vector de expresión)MG51068-G$75
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51068-NF$195
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51068-NH$195
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51068-NM$195
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51068-NY$195
Ratón IL-5/IL5 / Interleukin 5 clonación del ADN o clonación génica(vector de clonación)MG51068-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Interleukin 5 (IL-5) is a member of the interleukin family with length of 115 amino acids. Interleukins are a group of cytokines (secreted proteins / signaling molecules) that were first seen to be expressed by white blood cells (leukocytes) and has been found in a wide variety of body cells. Interleukin 5 or IL-5 is produced by T helper-2 cells and mast cells. It helps to stimulate B cell growth and increase immunoglobulin secretion and is considered as a key mediator in eosinophil activation. Interleukin 5 (IL-5) has long been associated with several allergic diseases, including allergic rhinitis and asthma. Growth in the number of circulating, airway tissue, and induced sputum eosinophils have been observed in patients with these diseases. IL-5 also had something with the terminally differentiated granulocyte eosinophils. IL-5 was originally found as an eosinophil colony stimulating factor. It has been proved to be a major regulator of eosinophil accumulation in tissues, and can modulate eosinophil behavior at every stage from maturation to survival.

  • Milburn MV, et al. (1993) A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature. 363(6425): 172-176.
  • Lee JS, et al. (1989) The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 15(2): 143-152.
  • Woodcock JM, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13 (21): 5176-85.
  • Size / Price
    Catálogo: MG51068-NF
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Mouse IL5 natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.