Pedido rápido

Ratón IL6R/IL-6R/CD126 clonación del ADN o clonación génica(vector de clonación)

  • Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Hoja de datosReseñasProductos relacionadosProtocolos
Ratón IL6R Información de producto de clon de cDNA
Gene_bank_ref_id:NM_010559.2
Tamaño de cDNA:1383bp
Descripción de cDNA:Full length Clone DNA of Mus musculus interleukin 6 receptor, alpha.
Sinónimo de gen:Apn, Cd13, Lap-1, Lap1, p150
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mIL6RA
Sitio de restricción:KpnI + XbaI (6.1kb + 1.38kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 486 T>C and 903 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL6R qPCR primers for gene expression analysis, MP200304 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón IL6R Gene Plasmid Map
Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Ratón IL6R/IL-6R/CD126 clonación del ADN o clonación génica(vector de clonación) on other vectors
Product nameProduct name
Fondo

Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine receptor. The low concentration of a soluble form of IL-6 receptor (sIL-6R) acts as an agonist of IL-6 activity. In the IL-6R/CD126/IL6R system, both a membrane-bound IL-6R and a sIL-6R protein are able to mediate IL-6 signals into the cells through the interaction of gp130. The resulting IL-6/sIL-6R protein complex is also capable of binding to gp130 and inducing intracellular signalling. Through this so-called 'trans-signalling' mechanism, IL-6 is able to stimulate cells that lack an endogenous mIL-6R. High levels of IL-6 and sIL-6R have been reported in several chronic inflammatory and autoimmune diseases as well as in cancer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Referencias
  • Barill S, et al. (2000) The role of interleukin-6 and interleukin-6/interleukin-6 receptor-alpha complex in the pathogenesis of multiple myeloma. Eur Cytokine Netw. 11(4): 546-51.
  • Kang KW, et al. (2007) Novel role of IL-6/SIL-6R signaling in the expression of inducible nitric oxide synthase (iNOS) in murine B16, metastatic melanoma clone F10.9, cells. Free Radic Biol Med. 42(2): 215-27.
  • Size / Price
    Catálogo: MG50280-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"