Pedido rápido

Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse IL7 Información de producto de clon de cDNA
Tamaño de cDNA:465bp
Descripción de cDNA:Full length Clone DNA of Mus musculus interleukin 7 with N terminal Myc tag.
Sinónimo de gen:Il-7, hlb368, MGC129342, A630026I06Rik
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50217-ACG$225
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50217-ACR$225
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50217-CF$195
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50217-CH$195
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50217-CM$195
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50217-CY$195
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(Vector de expresión)MG50217-M$75
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación)MG50217-M-N$195
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50217-NF$195
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50217-NH$195
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50217-NM$195
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50217-NY$195
Ratón IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación)MG50217-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

IL7, also known as interleukin 7, is a hematopoietic growth factor which belongs to the IL-7/IL-9 family. It is secreted by stromal cells in the bone marrow and thymus. IL7 stimulates the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. IL7 and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. It is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRß) during early T cell development. IL7 can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes.

  • Watanabe M, et al. (1995) Interleukin 7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes.
  • J Clin Invest. 95(6):2945-53. Sawa Y, et al. (2009) Hepatic interleukin-7 expression regulates T cell responses. Immunity. 30 (3):447-57.
  • Flad HD, et al. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol. 26(10): 2541-4.
  • Size / Price
    Catálogo: MG50217-NM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.