After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse INSR Información de producto de clon de cDNA
Gene_bank_ref_id:NM_010568.2
Tamaño de cDNA:4119bp
Descripción de cDNA:Full length Clone DNA of Mus musculus insulin receptor with N terminal Flag tag.
Sinónimo de gen:IR, IR-A, IR-B, CD220, 4932439J01Rik, D630014A15Rik, Insr
Especie:Mouse
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-mINSR
Sitio de restricción:HindIII + XbaI (6kb + 4.2kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 2076A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse INSR Gene Plasmid Map
Mouse INSR natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51062-ACG$375
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51062-ACR$375
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51062-CF$345
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51062-CH$345
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51062-CM$345
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51062-CY$345
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(Vector de expresión)MG51062-G$75
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51062-NF$345
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51062-NH$345
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51062-NM$345
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51062-NY$345
Ratón Insulin Receptor/INSR/CD220 clonación del ADN o clonación génica(vector de clonación)MG51062-UT$345
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

INSR (Insulin receptor), also known as CD220, is a transmembrane receptor that is activated by insulin. INSR belongs to theprotein kinase superfamily, and exists as a tetramer consisting of two alpha subunits and two beta subunits linked by disulfide bonds. The alpha and beta subunits are encoded by a single INSR gene, and the beta subunits pass through the cellular membrane. As the receptor for insulin with tyrosine-protein kinase activity, INSR associates with downstream mediators upon binding to insulin, including IRS1 (insulin receptor substrate 1) and phosphatidylinositol 3'-kinase (PI3K). IRS-1 binding and phosphorylation eventually leads to an increase in the high affinity glucose transporter (Glut4) molecules on the outer membrane of insulin-responsive tissues. INSR isoform long and isoform short are expressed in the peripheral nerve, kidney, liver, striated muscle, fibroblasts and skin, and is found as a hybrid receptor with IGF1R which also binds IGF1 in muscle, heart, kidney, adipose tissue, skeletal muscle, hepatoma, fibrobasts, spleen and placenta. Defects in Insulin Receptor/INSR are the cause of Rabson-Mendenhall syndrome (Mendenhall syndrome), insulin resistance (Ins resistance), leprechaunism (Donohue syndrome), and familial hyperinsulinemic hypoglycemia 5 (HHF5). It may also be associated with noninsulin-dependent diabetes mellitus (NIDDM).

Size / Price
Catálogo: MG51062-NF
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
  • Mouse INSR natural ORF mammalian expression plasmid, N-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"