CD18 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

CD18 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2313 bp
Description
Full length Clone DNA of Mouse integrin beta 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD18 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

2000000 cDNA ORF Clone, Mouse; AI528527 cDNA ORF Clone, Mouse; Cd18 cDNA ORF Clone, Mouse; LAD cDNA ORF Clone, Mouse; LCAMB cDNA ORF Clone, Mouse; Lfa1 cDNA ORF Clone, Mouse; MF17 cDNA ORF Clone, Mouse

CD18 Background Information

Integrins form a family of heterodimeric transmembrane receptors that regulate cell–adhesion and cell-extracellular matrix interactions. Lymphocyte function-associated antigen 1 (LFA-1, αLβ2) is a leukocyte specific integrin that mediates firm arrest of leukocytes on the endothelium during migration and establishes cell-cell contacts such as the immunological synapse between DCs and T cells. At the molecular level, transient modifications of adhesion are accomplished by conformational changes of LFA-1 from a bent down inactive to an upright active conformation with an open headpiece, leading to low- and high-affinity for its major ligand ICAM-1 respectively.
Full Name
integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Research Areas
References
  • Eich C, Lasonder E, Cruz LJ, et al. Proteome Based Construction of the Lymphocyte Function-Associated Antigen 1 (LFA-1) Interactome in Human Dendritic Cells. Mattei F, ed. PLoS ONE. 2016;11(2):e0149637.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait