After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ITK Información de producto de clon de cDNA
Tamaño de cDNA:1860bp
Descripción de cDNA:Full length Clone DNA of Mus musculus IL2-inducible T-cell kinase with C terminal Myc tag.
Sinónimo de gen:Emt, Tsk, Tcsk, Itk
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50361-ACG$245
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50361-ACR$245
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50361-ANG$245
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50361-ANR$245
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50361-CF$215
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50361-CH$215
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50361-CM$215
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50361-CY$215
Ratón ITK Kinase clonación del ADN o clonación génica(Vector de expresión)MG50361-M$75
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50361-NF$215
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50361-NH$215
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50361-NM$215
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50361-NY$215
Ratón ITK Kinase clonación del ADN o clonación génica(vector de clonación)MG50361-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

IL-2-inducible T cell kinase is a member of the protein kinase superfamily, Tyr protein kinase family and TEC subfamily. It contains 1 Btk-type zinc finger, 1 PH domain, 1 protein kinase domain, 1 SH2 domain and 1 SH3 domain. As an intracellular kinase which expressed in T-cells, IL-2-inducible T cell kinase contains both SH2 and SH3 domains which are often found in intracellular kinases. It is hought to play a role in T-cell proliferation and differentiation. It regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. IL-2-inducible T cell kinase also plays an essential role in regulation of the adaptive immune response. efects in IL-2-inducible T cell kinase are the cause of lymphoproliferative syndrome EBV-associated autosomal type 1 (LPSA1). LPSA1 is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Inadequate immune response to EBV can have a fatal outcome. Clinical features include splenomegaly, lymphadenopathy, anemia, thrombocytopenia, pancytopenia, recurrent infections. There is an increased risk for lymphoma.

  • Lee SH, et al. (2011) The association of a single-nucleotide polymorphism of the IL-2 inducible T-cell Kinase gene with asthma. Ann Hum Genet. 75(3):359-69.
  • Yao HL, et al. (2010) Effect of Itk down regulation on cytokines production in Jurkat cell. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 24(5):358-61.
  • Pechloff K, et al. (2010) The fusion kinase ITK-SYK mimics a T cell receptor signal and drives oncogenesis in conditional mouse models of peripheral T cell lymphoma. J Exp Med. 207(5):1031-44.
  • Size / Price
    Catálogo: MG50361-CM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.