After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse ITGA5 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_010577.2
Tamaño de cDNA:3162bp
Descripción de cDNA:Full length Clone DNA of Mus musculus integrin alpha 5 (fibronectin receptor alpha) with N terminal His tag.
Sinónimo de gen:Fnra, Cd49e, Itga5
Especie:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50133-ACG$325
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50133-ACR$325
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50133-CF$295
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50133-CH$295
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50133-CM$295
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50133-CY$295
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(Vector de expresión)MG50133-M$75
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50133-NF$295
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50133-NH$295
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50133-NM$295
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50133-NY$295
Ratón Integrin alpha 5/CD49e/ITGA5 clonación del ADN o clonación génica(vector de clonación)MG50133-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG50133-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"