After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse JAKMIP1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_178394.4
Tamaño de cDNA:1881bp
Descripción de cDNA:Full length Clone DNA of Mus musculus janus kinase and microtubule interacting protein 1.
Sinónimo de gen:Gababrbp, Marlin-1, 5830437M04Rik, C330021K24Rik
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51374-ACG$245
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51374-ACR$245
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51374-ANG$245
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51374-ANR$245
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51374-CF$215
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51374-CH$215
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51374-CM$215
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51374-CY$215
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51374-NF$215
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51374-NH$215
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51374-NM$215
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51374-NY$215
Ratón JAKMIP1 clonación del ADN o clonación génica(Vector de expresión)MG51374-U$75
Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación)MG51374-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51374-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"