Pedido rápido

Text Size:AAA

Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón JAKMIP1 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_178394.4
    Tamaño de cDNA:1881bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus janus kinase and microtubule interacting protein 1.
    Sinónimo de gen:Gababrbp, Marlin-1, 5830437M04Rik, C330021K24Rik
    Especie:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with JAKMIP1 qPCR primers for gene expression analysis, MP201247 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51374-ACG$245
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51374-ACR$245
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51374-ANG$245
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51374-ANR$245
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51374-CF$215
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51374-CH$215
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51374-CM$215
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51374-CY$215
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51374-NF$215
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51374-NH$215
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51374-NM$215
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51374-NY$215
    Ratón JAKMIP1 clonación del ADN o clonación génica(Vector de expresión)MG51374-U$75
    Ratón JAKMIP1 clonación del ADN o clonación génica(vector de clonación)MG51374-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG51374-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"