After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse JAM2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_023844.4
Tamaño de cDNA:897bp
Descripción de cDNA:Full length Clone DNA of Mus musculus junction adhesion molecule 2 with C terminal His tag.
Sinónimo de gen:JAM-2, JAM-B, Jcam2, VE-JAM, AU016127, 1110002N23Rik, 2410030G21Rik, 2410167M24Rik, Jam2
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50464-ACG$225
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50464-ACR$225
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50464-CF$195
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50464-CH$195
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50464-CM$195
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50464-CY$195
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(Vector de expresión)MG50464-M$75
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50464-NF$195
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50464-NH$195
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50464-NM$195
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50464-NY$195
Ratón Junctional Adhesion Molecule B clonación del ADN o clonación génica(vector de clonación)MG50464-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

Referencias
  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.
  • Size / Price
    Catálogo: MG50464-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"