KCNMB2 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

KCNMB2 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
708 bp
Description
Full length Clone DNA of Mouse potassium large conductance calcium-activated channel, subfamily M, beta member 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

KCNMB2 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

2700049B16Rik cDNA ORF Clone, Mouse; 3110031N04Rik cDNA ORF Clone, Mouse

KCNMB2 Background Information

Full Name
potassium channel subfamily M regulatory beta subunit 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait