After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Kell/Blood Group Kell clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse KEL Información de producto de clon de cDNA
Tamaño de cDNA:2142bp
Descripción de cDNA:Full length Clone DNA of Mus musculus Kell blood group with C terminal His tag.
Sinónimo de gen:Ece3, CD238, MGC107471, Kel
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón Kell/Blood Group Kell clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Product nameProduct name
Size / Price
Catálogo: MG50452-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.