Pedido rápido

Text Size:AAA

Ratón KIRREL1/NEPH1 clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse KIRREL Información de producto de clon de cDNA
Tamaño de cDNA:2370bp
Descripción de cDNA:Full length Clone DNA of Mus musculus kin of IRRE like (Drosophila) with N terminal Myc tag.
Sinónimo de gen:Neph1, Kirrel1, Kirrel
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

NEPH1 (KIRREL1) belongs to a family of three closely related transmembrane proteins of the Ig superfamily with a structure similar to that of nephrin. All three Neph proteins share a conserved podocin-binding motif; mutation of a centrally located tyrosine residue dramatically lowers the affinity of Neph1 for podocin. Neph1 triggers AP-1 activation similarly to nephrin but requires the presence of Tec family kinases for efficient transactivation. Neph1 consists of a signal peptide, five Ig-like C2-type domains with the middle domain overlapping with a PKD-like domain, an RGD sequence, a transmembrane domain and a cytoplasmic tail, which is expressed in slit diaphragm domains of podocytes and in vertebrate and invertebrate nervous systems. Neph1 is abundantly expressed in the kidney, specifically expressed in podocytes of kidney glomeruli, and plays a significant role in the normal development and function of the glomerular permeability. Neph1 interacts with nephrin in vitro and in vivo, and able to stimulate transcriptional activation in a model system, such as the activation the transcription factor AP-1 via the stimulation of a MAPK module. Neph1 is crucial for the integrity of the slit diaphragm, as Neph1 gene knockout mice results in effacement of glomerular podocytes, heavy proteinuria, and early postnatal death.

  • Sellin L, et al. (2003) NEPH1 defines a novel family of podocin interacting proteins. FASEB J. 17(1): 115-7.
  • Kim EY, et al. (2009) Neph1 regulates steady-state surface expression of Slo1 Ca(2+)-activated K(+) channels: different effects in embryonic neurons and podocytes. Am J Physiol Cell Physiol. 297(6): C1379-88.
  • Size / Price
    Catálogo: MG50193-NM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.