Kallikrein 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

Kallikrein 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Mouse kallikrein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Kallikrein 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

0610007D04Rik cDNA ORF Clone, Mouse; Kal cDNA ORF Clone, Mouse; Klk1b6 cDNA ORF Clone, Mouse; Klk6 cDNA ORF Clone, Mouse; mGk-6 cDNA ORF Clone, Mouse

Kallikrein 1 Background Information

Human tissue kallikrein (KLK1) is a serine protease, component of the KKS that has been demonstrated to exert pleiotropic beneficial effects in protection from tissue injury through its antiinflammatory, antiapoptotic, antifibrotic and antioxidative actions.Polymorphism of the human tissue kallikrein 1 (KLK1) A1789G gene is associated with susceptibility to hypertension.
Full Name
kallikrein 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait