Lipocalin-2 / LCN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag

1/1
Price:
Size:
Number:

Lipocalin-2 / LCN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
603 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse lipocalin 2 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.29kb)
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Lipocalin-2 / LCN2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Lipocalin-2 / LCN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag: Validated Images

Lipocalin-2 / LCN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag: Alternative Names

24p3 cDNA ORF Clone, Mouse; AW212229 cDNA ORF Clone, Mouse; Sip24 cDNA ORF Clone, Mouse

Lipocalin-2 / LCN2 Background Information

Lipocalin-2 (LCN2), also known as neutrophil gelatinase-associated lipocalin (NGAL), is a 25 kDa protein belonging to the lipocalin superfamily. It was initially found in activated neutrophils, however, many other cells, like kidney tubular cells, may produce NGAL in response to various insults. This protein is released from injured tubular cells after various damaging stimuli, is already known by nephrologists as one of the most promising biomarkers of incoming Acute Kidney Injury (AKI). Recent evidence also suggests its role as a biomarker in a variety of other renal and non-renal conditions. Moreover, recent studies seem to suggest a potential involvement of this factor also in the genesis and progression of chronic kidney diseases. NGAL is the first known mammalian protein which specifically binds organic molecules called siderophores, which are high-affinity iron chelators. NGAL, first known as an antibacterial factor of natural immunity, and an acute phase protein, is currently one of the most interesting and enigmatic proteins involved in the process of tumor development. acting as an intracellular iron carrier and protecting MMP9 from proteolytic degradation, NGAL has a clear pro-tumoral effect, as has already been observed in different tumors (e.g. breast, stomach, oesophagus, brain) in humans. In thyroid carcinomas, NGAL is strongly induced by NF-kB, an important factor involved both in tumor growth and in the link between chronic inflammation and neoplastic development. Thus, Lipocalin-2 (LCN2/NGAL) has been implicated in a variety of processes including cell differentiation, proliferation, survival and morphogenesis.
Full Name
lipocalin 2
References
  • Schmidt-Ott KM, et al. (2006) Neutrophil gelatinase-associated lipocalin-mediated iron traffic in kidney epithelia. Curr Opin Nephrol Hypertens. 15(4): 442-9.
  • Bolignano D, et al. (2010) Neutrophil gelatinase-associated lipocalin (NGAL) in human neoplasias: a new protein enters the scene. Cancer Lett. 288(1): 10-6.
  • Soni SS, et al. (2010) NGAL: a biomarker of acute kidney injury and other systemic conditions. Int Urol Nephrol. 42(1): 141-50.
  • Bolignano D, et al. (2010) From kidney to cardiovascular diseases: NGAL as a biomarker beyond the confines of nephrology. Eur J Clin Invest. 40(3): 273-6.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait