Pedido rápido

Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ratón LMNA Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001111102.2
Tamaño de cDNA:1725bp
Descripción de cDNA:Full length Clone DNA of Mus musculus lamin A with C terminal His tag.
Sinónimo de gen:Dhe
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with LMNA qPCR primers for gene expression analysis, MP201586 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51713-ACG$245
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51713-ACR$245
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51713-ANG$245
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51713-ANR$245
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51713-CF$215
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51713-CH$215
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51713-CM$215
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51713-CY$215
Ratón LMNA/lamins A clonación del ADN o clonación génica(Vector de expresión)MG51713-G$75
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51713-NF$215
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51713-NH$215
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51713-NM$215
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51713-NY$215
Ratón LMNA/lamins A clonación del ADN o clonación génica(vector de clonación)MG51713-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51713-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad
Añadir a carroBulk Discount Requiry
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"