MD1 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

MD1 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
489 bp
Description
Full length Clone DNA of Mouse lymphocyte antigen 86 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MD1 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

MD-1 cDNA ORF Clone, Mouse; MD1 cDNA ORF Clone, Mouse

MD1 Background Information

MD-1 and MD-2 are secretory glycoproteins that exist on the cell surface in complexes with transmembrane proteins. MD-1 is anchored by radioprotective 15 (RP15) which is a molecule containing leucine-rich repeats and is expressed on B cells, dentritic cells and macrophages, while MD-2 is associated with TLR4. MD-1 is required for efficient RP15 cell surface expression and function. It is indicated that the RP15/MD1 complex, in conjunction with TLR4, mediates the innate immune response to LPS in B cells, and also plays a role in protecting against apoptosis, B-cell proliferation, etc. Mouse MD-1 cDNA encodes a 162 amino acid precursor protein with a putative 19 aa signal peptide and two potential N-linked glycosylation sites. It shares 4% and 66% amino acid sequence identity with chicken and human MD-1 respectively. MD-1 is mainly expressed in spleen, and also detectable in liver, brain, thymus, and kidney.
Full Name
lymphocyte antigen 86
References
  • Miura Y., et al.,(1998), RP105 is associated with MD-1 and transmits an activation signal in human B cells. Blood 92:2815-2822.
  • Begum N.A., et al., (1999), Human MD-1 homologue is a BCG-regulated gene product in monocytes: Its identification by differential display.Biochem. Biophys. Res. Commun. 256:325-329.
  • Mungall A.J., et al.,(2003), The DNA sequence and analysis of human chromosome 6.Nature 425:805-811.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait