Pedido rápido

Text Size:AAA

Mouse LYPD3 ORF mammalian expression plasmid, N-HA tag

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse LYPD3 Información de producto de clon de cDNA
Tamaño de cDNA:1092bp
Descripción de cDNA:Full length Clone DNA of Mus musculus Ly6/Plaur domain containing 3 with N terminal HA tag.
Sinónimo de gen:C4.4a, 2310061G07Rik, Lypd3
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Ly6 / PLAUR domain-containing protein 3, also known as GPI-anchored metastasis-associated protein C4.4A homolog, Matrigel-induced gene C4 protein, MIG-C4 and LYPD3, is a cell membrane protein which contains two UPAR/Ly6 domains. Human LYPD3 contains two UPAR/Ly6 domains. LYPD3 is expressed in placenta, skin and urothelium. It is found in suprabasal keratinocytes of chronic wounds. Weak expression of LYPD3 is found in esophagus and peripheral blood mononuclear cells. It is found in the majority of primary and metastatic transitional cell carcinomas (TCCs) and as well in breast cancer tissues, but not in adjacent normal tissues. High expression of LYPD3 is found in the tumor component of some noninvasive superficial lesions and in invasive and metastatic urothelial cancers. LYPD3 is up-regulated in migrating keratinocytes during epithelisation of incisional skin wounds. LYPD3 supports cell migration. It may be involved in urothelial cell-matrix interactions. It may also be involved in tumor progression

  • Smith B.A., et al., 2001, Cancer Res. 61:1678-85.
  • Wuerfel J., et al., 2001, Gene 262:35-41.
  • Clark H.F., et al., 2003, Genome Res. 13:2265-70.
  • Fletcher G.C., et al., 2003, Br. J. Cancer 88:579-85.
  • Hansen L.V., et al., 2004, Biochem. Eng. J. 380:845-57.
  • Size / Price
    Catálogo: MG50546-NY
    Precio de lista:   (Save )
    Precio:      [How to order]
    Disponibilidad2-3 weeksInstrucciones de envío
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.