After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse MAGED1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_019791.2
Tamaño de cDNA:2328bp
Descripción de cDNA:Full length Clone DNA of Mus musculus melanoma antigen, family D, 1 with N terminal His tag.
Sinónimo de gen:NRAGE; Dlixin; Dlxin1; Dlxin-1; MAGE-D1; mFLJ00163; DXBwg1492e; 2810433C11Rik; 5430405L04Rik
Especie:Mouse
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51399-ACG$245
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51399-ACR$245
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51399-ANG$245
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51399-ANR$245
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51399-CF$75
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51399-CH$215
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51399-CM$215
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51399-CY$215
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51399-NF$215
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51399-NH$215
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51399-NM$215
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51399-NY$215
Ratón MAGED1 clonación del ADN o clonación génica(Vector de expresión)MG51399-U$75
Ratón MAGED1 clonación del ADN o clonación génica(vector de clonación)MG51399-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51399-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"