Pedido rápido

Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón MAP2K2 Información de producto de clon de cDNA
    Tamaño de cDNA:1206bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus mitogen-activated protein kinase kinase 2 with C terminal Myc tag.
    Sinónimo de gen:MK2, MEK2, Prkmk2, AA589381
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    ( We provide with MAP2K2 qPCR primers for gene expression analysis, MP200361 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50338-ACG$225
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50338-ACR$225
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50338-ANG$225
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50338-ANR$225
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50338-CF$195
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50338-CH$195
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50338-CM$195
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50338-CY$195
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(Vector de expresión)MG50338-G$75
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50338-NF$195
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50338-NH$195
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50338-NM$195
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50338-NY$195
    Ratón MEK2/MAP2K2/MKK2 clonación del ADN o clonación génica(vector de clonación)MG50338-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name

    Dual specificity mitogen-activated protein kinase kinase 2, also known as MAP kinase kinase 2, MAPKK2, ERK activator kinase 2, MAPK / ERK kinase 2, MEK2 and MAP2K2, is a member of the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K2 / MEK2 contains one protein kinase domain. MEK1 and MEK2 (also known as MAP2K1 and MAP2K2, respectively) are evolutionarily conserved, dual-specificity kinases that mediate Erk1 and Erk2 activation during adhesion and growth factor signaling. MAP2K1 / MEK1 is a crucial modulator of Mek and Erk signaling and have potential implications for the role of MEK1 and MEK2 in tumorigenesis. MAP2K2 / MEK2 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. It also activates the ERK1 and ERK2 MAP kinases. Defects in MAP2K2 are a cause of cardiofaciocutaneous syndrome (CFC syndrome) which is characterized by a distinctive facial appearance, heart defects and mental retardation. Heart defects include pulmonic stenosis, atrial septal defects and hypertrophic cardiomyopathy.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • MacDonald,T.J. et al., 2001, Nat Genet. 29 (2):143-52.
  • Mittal R., et al., 2006, Proc. Natl. Acad. Sci. USA. 103:18574-9.
  • Narumi,Y. et al., 2007, Am J Med Genet A. 143A (8):799-807.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Catalanotti,F. et al., 2009, Nat Struct Mol Biol. 16 (3):294-303.
  • Size / Price
    Catálogo: MG50338-CM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.