Pedido rápido

Text Size:AAA

Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse MAPK9 Información de producto de clon de cDNA
Tamaño de cDNA:1146bp
Descripción de cDNA:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 9 with C terminal Flag tag.
Sinónimo de gen:JNK2, Prkm9, AI851083, p54aSAPK, Mapk9
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51022-ACG$225
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51022-ACR$225
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51022-ANG$225
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51022-ANR$225
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51022-CF$195
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51022-CH$195
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51022-CM$195
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51022-CY$195
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(Vector de expresión)MG51022-G$75
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51022-NF$195
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51022-NH$195
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51022-NM$195
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51022-NY$195
Ratón JNK2/MAPK9 clonación del ADN o clonación génica(vector de clonación)MG51022-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Mitogen-activated protein kinase 9 (MAPK9), also well known as c-Jun N-terminal kinase (JNK2), is a member of MAP kinase subfamily belonging to the protein kinase superfamily. MAPK9 responds to activation by environmental stress and pro-inflammatory cytokines by phosphorylating a number of transcription factors, such as c-Jun and ATF2. The crystal structure of human JNK2 complexed with an indazole inhibitor by applying a high-throughput protein engineering and surface-site mutagenesis approach. A novel conformation of the activation loop is observed, which is not compatible with its phosphorylation by upstream kinases. This activation inhibitory conformation of JNK2 is stabilized by the MAP kinase insert that interacts with the activation loop in an induced-fit manner. It suggest that the MAP kinase insert of JNK2 plays a role in the regulation of JNK2 activation, possibly by interacting with intracellular binding partners. JNK2 deficiency leads to reduced c-Jun degradation, thereby augmenting c-Jun levels and cellular proliferation, and suggests that JNK2 is a negative regulator of cellular proliferation in multiple cell types. JNK2 prevents replicative stress by coordinating cell cycle progression and DNA damage repair mechanisms. JNK2 blocks the ubiquitination of tumor suppressor p53, and thus increases the stability of p53 in nonstressed cells. JNK2 negatively regulates antigen-specific CD8+ T cell expansion and effector function, and thus selectively blocking JNK2 in CD8+ T cells may potentially enhance anti-tumor immune response. Lack of JNK2 expression was associated with higher tumor aneuploidy and reduced DNA damage response. Additionally,the JNK2 protein could be a novel therapeutic target in dry eye disease, and may provide a novel target for prevention of vascular disease and atherosclerosis.

  • Sabapathy K, et al. (2004) JNK2: a negative regulator of cellular proliferation. Cell Cycle. 3(12): 1520-3.
  • Tao J, et al. (2007) JNK2 negatively regulates CD8+ T cell effector function and anti-tumor immune response. Eur J Immunol. 37(3): 818-29.
  • Shaw D, et al. (2008) The crystal structure of JNK2 reveals conformational flexibility in the MAP kinase insert and indicates its involvement in the regulation of catalytic activity. J Mol Biol. 383(4): 885-93.
  • Osto E, et al. (2008) c-Jun N-terminal kinase 2 deficiency protects against hypercholesterolemia-induced endothelial dysfunction and oxidative stress. 118(20): 2073-80.
  • De Paiva CS, et al. (2009) Essential role for c-Jun N-terminal kinase 2 in corneal epithelial response to desiccating stress. Arch Ophthalmol. 127(12): 1625-31.
  • Chen P, et al. (2010) Jnk2 effects on tumor development, genetic instability and replicative stress in an oncogene-driven mouse mammary tumor model. PLoS One. 5(5): e10443.
  • Size / Price
    Catálogo: MG51022-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.