After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón CD146/MCAM clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse MCAM Información de producto de clon de cDNA
Tamaño de cDNA:1947bp
Descripción de cDNA:Full length Clone DNA of Mus musculus melanoma cell adhesion molecule with N terminal Myc tag.
Sinónimo de gen:CD146, CD149, Muc18, s-endo, AV025631, 1-gicerin, s-gicerin, Mcam
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

The CD146 antigen, also known as melanoma cell adhesion molecule (MCAM) and MUC18, is an integral membrane glycoprotein belonging to the immunoglobulin superfamily. CD146 contains the characteristic immunoglobulin-like domains (V-V-C2-C2-C2), a transmembrane region and a short cytoplasmic tail. The CD146 expression is detected in endothelial cells in vascular tissue throughout the body, and plays a role in cell adhesion, as well as in cohesion of the endothelial monolayer at intercellular junctions in vascular tissue. As a Ca2+-independent cell adhesion molecule involved in heterophilic cell to cell interactions and a surface receptor, CD146 triggers tyrosine phosphorylation of FYN and PTK2 and subsequently induced signal transduction, proteolysis, or immune recognition. This protein is also expressed predominantly on metastatic lesions and advanced primary tumours, and thus has been suggested to play an important role in tumour progression and the development of metastasis in certain human carcinomas.

  • Mills L, et al. (2002) Fully human antibodies to MCAM/MUC18 inhibit tumor growth and metastasis of human melanoma. Cancer Res. 62(17): 5106-14.
  • Taira E, et al. (2004) Characterization of Gicerin/MUC18/CD146 in the rat nervous system. J Cell Physiol. 198(3): 377-87.
  • Fritzsche FR, et al. (2008) CD146 protein in prostate cancer: revisited with two different antibodies. Pathology. 40(5): 457-64.
  • Bidlingmaier S, et al. (2009) Identification of MCAM/CD146 as the target antigen of a human monoclonal antibody that recognizes both epithelioid and sarcomatoid types of mesothelioma. Cancer Res. 69(4): 1570-7.
  • Boneberg EM, et al. (2009) Soluble CD146 is generated by ectodomain shedding of membrane CD146 in a calcium-induced, matrix metalloprotease-dependent process. Microvasc Res. 78(3): 325-31.
  • Size / Price
    Catálogo: MG50794-NM
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.