Pedido rápido

Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón MDM2 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_010786.3
    Tamaño de cDNA:1470bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus transformed mouse 3T3 cell double minute 2 with N terminal HA tag.
    Sinónimo de gen:Mdm-2, AA415488, 1700007J15Rik, Mdm2
    Especie:Mouse
    Vector:pCMV3-N-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MDM2 qPCR primers for gene expression analysis, MP200525 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50533-ACG$225
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50533-ACR$225
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50533-ANG$225
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50533-ANR$225
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50533-CF$195
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50533-CH$195
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50533-CM$195
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50533-CY$195
    Ratón MDM2 clonación del ADN o clonación génica(Vector de expresión)MG50533-M$75
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50533-M-F$195
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50533-NF$195
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50533-NH$195
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50533-NM$195
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50533-NY$195
    Ratón MDM2 clonación del ADN o clonación génica(vector de clonación)MG50533-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    MDM2 gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referencias
  • Zhuo X, Ye H, Li Q, Xiang Z, Zhang X. Is MDM2 SNP309 Variation a Risk Factor for Head and Neck Carcinoma?: An Updated Meta-Analysis Based on 11,552 Individuals. Langevin. S, ed. Medicine. 2016;95(9):e2948.
  • Size / Price
    Catálogo: MG50533-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"