Meprin alpha cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50057-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Meprin alpha Reagents

CRO Services

Product recommended


All Meprin alpha Reagents

Meprin alpha cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2283 bp
Description
Full length Clone DNA of Mouse meprin 1 alpha with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Meprin alpha cDNA ORF Clone, Mouse, C-HA tag Alternative Names

AI098089 cDNA ORF Clone, Mouse;AW107200 cDNA ORF Clone, Mouse;Mep-1 cDNA ORF Clone, Mouse;Mep-1a cDNA ORF Clone, Mouse;Mep1 cDNA ORF Clone, Mouse

Meprin alpha Background Information

Meprin A subunit alpha, also known as MEP1A, and Endopeptidase-2, is a single-pass type I  membrane protein which belongs to the peptidase M12A family. MEP1A contains one EGF-like domain, one MAM domain, and one MATH domain. Meprins are unique plasma membrane and secreted metalloproteinases that are highly regulated at the transcriptional and post-translational levels. Meprin alpha and beta subunits are abundantly expressed in kidney and intestinal epithelial cells, are secreted into the urinary tract and intestinal lumen, and are found in leukocytes and cancer cells under certain conditions. Meprins are capable of proteolytically degrading extracellular matrix proteins, proteolytically processing bioactive proteins, and play a role in inflammatory processes. Meprin A and B are highly regulated, secreted and cell-surface homo- and hetero-oligomeric enzymes. Meprins are abundantly expressed in kidney and intestine. The multidomain alpha and beta subunits have high sequence identity. They have very different substrate specificities, oligomerization potentials and are differentially regulated. Meprin A appears to be an important therapeutic target and urinary excretion appears to be a potential biomarker of acute kidney injury ( AKI ).
Full Name
meprin A, alpha (PABA peptide hydrolase)
References
  • Bertenshaw,GP. et al., 2002, Biol Chem. 383 (7-8):1175-83.
  • Bond, JS. et al., 2005, FEBS Lett. 579 (15): 3317-22.
  • Herzog, C. et al., 2007, Kidney Int. 71 (10): 1009-18.
  • Yura, RE. et al., 2009, Am J Physiol Renal Physiol. 296 (1): F135-44.
  • Meprin alpha cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Meprin alpha cDNA ORF Clone in Cloning Vector, Mouse MG50057-M
    Meprin alpha cDNA ORF Clone, Mouse, untagged MG50057-UT
    Meprin alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50057-ACG
    Meprin alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50057-ACGLN
    Meprin alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50057-ACR
    Meprin alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50057-CF
    Meprin alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50057-NF
    Meprin alpha cDNA ORF Clone, Mouse, C-His tag MG50057-CH
    Meprin alpha cDNA ORF Clone, Mouse, N-His tag MG50057-NH
    Meprin alpha cDNA ORF Clone, Mouse, N-HA tag MG50057-NY
    Meprin alpha cDNA ORF Clone, Mouse, C-Myc tag MG50057-CM
    Meprin alpha cDNA ORF Clone, Mouse, N-Myc tag MG50057-NM
    Meprin alpha qPCR Primer Pairs, Mouse MP200057

    Meprin alpha cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Meprin alpha cDNA ORF Clone in Cloning Vector, Human HG10133-M
    Meprin alpha cDNA ORF Clone, Human, untagged HG10133-UT
    Meprin alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG10133-ACG
    Meprin alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10133-ACGLN
    Meprin alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG10133-ACR
    Meprin alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10133-CF
    Meprin alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10133-NF
    Meprin alpha cDNA ORF Clone, Human, C-His tag HG10133-CH
    Meprin alpha cDNA ORF Clone, Human, N-His tag HG10133-NH
    Meprin alpha cDNA ORF Clone, Human, C-HA tag HG10133-CY
    Meprin alpha cDNA ORF Clone, Human, N-HA tag HG10133-NY
    Meprin alpha cDNA ORF Clone, Human, C-Myc tag HG10133-CM
    Meprin alpha cDNA ORF Clone, Human, N-Myc tag HG10133-NM
    Meprin alpha qPCR Primer Pairs, Human HP100205
    info info
    添加购物车成功! 添加购物车失败!