Pedido rápido

Text Size:AAA

Ratón MERTK/Mer clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse MERTK Información de producto de clon de cDNA
Tamaño de cDNA:2985bp
Descripción de cDNA:Full length Clone DNA of Mus musculus c-mer proto-oncogene tyrosine kinase with C terminal HA tag.
Sinónimo de gen:Eyk, Mer, Nyk, Mertk
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

&Proto-oncogene tyrosine-protein kinase MER (MERTK) is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. MERTK is localized in membrane and is no expressed in normal B- and T-lymphocytes but is expressed in numerous neoplastic B- and T-cell lines. This protein is highly expressed in testis, ovary, prostate, lung, and kidney, with lower expression in spleen, small intestine, colon, and liver. MERTK regulates many physiological processes including cell survival, migration, differentiation, and phagocytosis of apoptotic cells (efferocytosis). Ligand binding at the cell surface induces autophosphorylation of MERTK on its intracellular domain that provides docking sites for downstream signaling molecules. MERTK signaling plays a role in various processes such as macrophage clearance of apoptotic cells, platelet aggregation, cytoskeleton reorganization and engulfment. MERTK plays also an important role in inhibition of Toll-like receptors (TLRs)-mediated innate immune response by activating STAT1, which selectively induces production of suppressors of cytokine signaling SOCS1 and SOCS3. Defects in MERTK are the cause of retinitis pigmentosa type 38.

  • Thompson DA, et al. (2002) Retinal dystrophy due to paternal isodisomy for chromosome 1 or chromosome 2, with homoallelism for mutations in RPE65 or MERTK, respectively. Am J Hum Genet. 70 (1): 224-9.
  • Tada A, et al. (2006) Screening of the MERTK gene for mutations in Japanese patients with autosomal recessive retinitis pigmentosa. Mol Vis. 12: 441-4.
  • McHenry CL, et al. (2004) MERTK arginine-844-cysteine in a patient with severe rod-cone dystrophy: loss of mutant protein function in transfected cells. Invest Ophthalmol. Vis Sci. 45 (5): 1456-63.
  • Size / Price
    Catálogo: MG50514-CY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.