MIF cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

MIF cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
348 bp
Description
Full length Clone DNA of Mouse macrophage migration inhibitory factor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MIF cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

GIF cDNA ORF Clone, Mouse; Glif cDNA ORF Clone, Mouse

MIF Background Information

Macrophage migration inhibitory factor (MIF) is an immunoregulatory cytokine, the effect of which on arresting random immune cell movement was recognized several decades ago. Despite its historic name, MIF also has a direct chemokine-like function and promotes cell recruitment. MIF is an ubiquitously expressed protein that plays a crucial role in many inflammatory and autoimmune disorders. Increasing evidence suggests that MIF also controls metabolic and inflammatory processes underlying the development of metabolic pathologies associated with obesity. Further research has shown that MIF plays a particularly critical part in cell cycle regulation and therefore in tumorigenesis as well. The significance of the role of MIF in a variety of both solid and hematologic tumors has been established. More recently, interest has increased in the role of MIF in the development of central nervous system (CNS) tumors, in which it appears to influence cell cycle control. MIF contributes to malignant disease progression on several different levels. Both circulating and intracellular MIF protein levels are elevated in cancer patients and MIF expression reportedly correlates with stage, metastatic spread and disease-free survival. Blockade of MIF bioactivity successfully inhibited tumor cell growth in vivo and in vitro. MIF plays important roles in the pathogenesis of gastrointestinal, hepatic, and pancreatic disorders.
Full Name
macrophage migration inhibitory factor (glycosylation-inhibiting factor)
References
  • Ohkawara T, et al. (2005) Pathophysiological roles of macrophage migration inhibitory factor in gastrointestinal, hepatic, and pancreatic disorders. J Gastroenterol. 40(2): 117-22.
  • Bach JP, et al.. (2009) The role of macrophage inhibitory factor in tumorigenesis and central nervous system tumors. Cancer. 115(10): 2031-40.
  • Rendon BE, et al.. (2009) Mechanisms of macrophage migration inhibitory factor (MIF)-dependent tumor microenvironmental adaptation. Exp Mol Pathol. 86(3): 180-5.
  • Grieb G, et al. (2010) Macrophage migration inhibitory factor (MIF): a promising biomarker. Drug News Perspect. 23(4): 257-64.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait