Pedido rápido

Ratón MMP-8 / MMP8 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse MMP8 Información de producto de clon de cDNA
Tamaño de cDNA:1398bp
Descripción de cDNA:Full length Clone DNA of Mus musculus matrix metallopeptidase 8 with C terminal HA tag.
Sinónimo de gen:BB138268, Mmp8
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Neutrophil collagenase, also known as Matrix metalloproteinase-8, MMP-8, and CLG1, is a member of the peptidase M10A family. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 in the tumour may have a protective effect against lymph node metastasis. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 participates in wound repair by contributing to the resolution of inflammation and open the possibility to develop new strategies for treating wound healing defects.

Size / Price
Catálogo: MG50493-CY
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.