Pedido rápido

Text Size:AAA

Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse MMP9 Información de producto de clon de cDNA
Tamaño de cDNA:2193bp
Descripción de cDNA:Full length Clone DNA of Mus musculus matrix metallopeptidase 9 with N terminal HA tag.
Sinónimo de gen:Clg4b, MMP-9, B/MMP9, AW743869, pro-MMP-9, Mmp9
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50560-ACG$245
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50560-ACR$245
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50560-CF$215
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50560-CH$215
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50560-CM$215
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50560-CY$215
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(Vector de expresión)MG50560-M$75
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50560-M-H$215
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50560-NF$215
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50560-NH$215
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50560-NM$215
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50560-NY$215
Ratón MMP9/MMP-9/CLG4B clonación del ADN o clonación génica(vector de clonación)MG50560-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

Matrix metalloproteinases (MMPs) are neutral proteinases that are involved in the breakdown and remodeling of the extracellular matrix (ECM) under a variety of physiological and pathological conditions, such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. MMP9, also known as 92-kDa gelatinase B/type IV collagenase, is secreted from neutrophils, macrophages, and a number of transformed cells, and is the most complex family member in terms of domain structure and regulation of its activity. It plays an important role in tissue remodelling in normal and pathological inflammatory processes. MMP-9 is a major secretion product of macrophages and a component of cytoplasmic granules of neutrophils, and is particularly important in the pathogenesis of inflammatory, infectious, and neoplastic diseases in many organs including the lung. This enzyme is also secreted by lymphocytes and stromal cells upon stimulation by inflammatory cytokines, or upon delivery of bi-directional activation signals following integrin-mediated cell-cell or cell-extracellular matrix (ECM) contacts. Since the integrity of the tissue architecture is closely dependent of the delicate balance between MMPs and their inhibitors, excessive production of MMP-9 is linked to tissue damage and degenerative inflammatory disorders. As a consequence, regulation of gene transcription and tissue-specific expression of MMP-9 in normal and diseased states are being actively investigated to pave the way for new therapeutic targets. In addition, the dramatic overexpression of MMP-9 in cancer and various inflammatory conditions clearly points to the molecular mechanisms controlling its expression as a potential target for eventual rational therapeutic intervention.

  • St-Pierre Y, et al. (2003) Emerging features in the regulation of MMP-9 gene expression for the development of novel molecular targets and therapeutic strategies. Curr Drug Targets Inflamm Allergy. 2(3): 206-15.
  • St-Pierre Y, et al. (2004) Regulation of MMP-9 gene expression for the development of novel molecular targets against cancer and inflammatory diseases. Expert Opin Ther Targets. 8(5): 473-89.
  • Chakrabarti S, et al. (2005) Matrix metalloproteinase-2 (MMP-2) and MMP-9 in pulmonary pathology. Exp Lung Res. 31(6): 599-621.
  • Size / Price
    Catálogo: MG50560-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.