Pedido rápido

Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ratón MPHOSPH6 Información de producto de clon de cDNA
Tamaño de cDNA:486bp
Descripción de cDNA:Full length Clone DNA of Mus musculus M phase phosphoprotein 6 with N terminal His tag.
Sinónimo de gen:C86426, AA536809, 1110001M01Rik
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52816-ACG$225
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52816-ACR$225
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52816-ANG$225
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52816-ANR$225
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52816-CF$195
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52816-CH$195
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52816-CM$195
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52816-CY$195
Ratón MPHOSPH6 clonación del ADN o clonación génica(Vector de expresión)MG52816-G$75
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52816-NF$195
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52816-NH$195
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52816-NM$195
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52816-NY$195
Ratón MPHOSPH6 clonación del ADN o clonación génica(vector de clonación)MG52816-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG52816-NH
Precio de lista: 
Precio:      (You Save: )
Añadir a carroBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.