After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse MST4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_133729.1
Tamaño de cDNA:1020bp
Descripción de cDNA:Full length Clone DNA of Mus musculus RIKEN cDNA 2610018G03 gene with C terminal His tag.
Sinónimo de gen:Mst4, RP23-245F8.1, 2610018G03Rik
Especie:Mouse
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51088-ACG$225
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51088-ACR$225
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51088-ANG$225
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51088-ANR$225
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51088-CF$195
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51088-CH$195
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51088-CM$195
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51088-CY$195
Ratón MST4/MST-4 clonación del ADN o clonación génica(Vector de expresión)MG51088-G$75
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51088-NF$195
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51088-NH$195
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51088-NM$195
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51088-NY$195
Ratón MST4/MST-4 clonación del ADN o clonación génica(vector de clonación)MG51088-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.

Referencias

1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

Size / Price
Catálogo: MG51088-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"