Pedido rápido

Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón MTHFD2 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_008638.2
    Tamaño de cDNA:1053bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus methylenetetrahydrofolate dehydrogenase (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase with N terminal His tag.
    Sinónimo de gen:NMDMC, AW558851
    Especie:Mouse
    Vector:pCMV3-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52822-ACG$225
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52822-ACR$225
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52822-ANG$225
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52822-ANR$225
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52822-CF$195
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52822-CH$195
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52822-CM$195
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52822-CY$195
    Ratón MTHFD2 clonación del ADN o clonación génica(Vector de expresión)MG52822-G$75
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52822-NF$195
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52822-NH$195
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52822-NM$195
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52822-NY$195
    Ratón MTHFD2 clonación del ADN o clonación génica(vector de clonación)MG52822-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: MG52822-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"