After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse MYL12B Información de producto de clon de cDNA
Gene_bank_ref_id:NM_023402.2
Tamaño de cDNA:519bp
Descripción de cDNA:Full length Clone DNA of Mus musculus myosin, light chain 12B, regulatory with N terminal His tag.
Sinónimo de gen:RLC-B, C77744, Mylc2b, 1500001M02Rik
Especie:Mouse
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50729-ACG$225
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50729-ACR$225
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50729-ANG$225
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50729-ANR$225
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50729-CF$195
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50729-CH$195
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50729-CM$195
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50729-CY$195
Ratón MYL12B clonación del ADN o clonación génica(Vector de expresión)MG50729-G$75
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50729-NF$195
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50729-NH$195
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50729-NM$195
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50729-NY$195
Ratón MYL12B clonación del ADN o clonación génica(vector de clonación)MG50729-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG50729-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"