After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse NCF2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_010877.4
Tamaño de cDNA:1578bp
Descripción de cDNA:Full length Clone DNA of Mus musculus neutrophil cytosolic factor 2.
Sinónimo de gen:NOXA2, Ncf-2, p67phox
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52449-ACG$245
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52449-ACR$245
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52449-ANG$245
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52449-ANR$245
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52449-CF$215
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52449-CH$215
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52449-CM$215
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52449-CY$215
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(Vector de expresión)MG52449-G$75
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52449-NF$215
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52449-NH$215
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52449-NM$215
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52449-NY$215
Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación)MG52449-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

NCF2, also known as NCF-2 and p67phox, is a subunit of the multi-protein NADPH oxidase complex. NCF2, NCF1, and a membrane bound cytochrome b558 are required for activation of the latent NADPH oxidase. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in NCF2 gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms.

Referencias
  • Wientjes FB. et al., 1996, Semin Cell Biol. 6 (6): 357-65.
  • DeLeo FR. et al., 1997, J Leukoc Biol. 60 (6): 677-91.
  • Dorseuil O. et al., 1997, C R Seances Soc Biol Fil. 191 (2): 237-46.
  • Size / Price
    Catálogo: MG52449-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"