Pedido rápido

Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón NCF2 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_010877.4
    Tamaño de cDNA:1578bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus neutrophil cytosolic factor 2.
    Sinónimo de gen:NOXA2, Ncf-2, p67phox
    Especie:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NCF2 qPCR primers for gene expression analysis, MP202322 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación) on other vectors
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG52449-ACG$245
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG52449-ACR$245
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG52449-ANG$245
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG52449-ANR$245
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG52449-CF$215
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG52449-CH$215
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG52449-CM$215
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG52449-CY$215
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(Vector de expresión)MG52449-G$75
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG52449-NF$215
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG52449-NH$215
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG52449-NM$215
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG52449-NY$215
    Ratón NCF2 / NCF-2 / P67phox clonación del ADN o clonación génica(vector de clonación)MG52449-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    NCF2, also known as NCF-2 and p67phox, is a subunit of the multi-protein NADPH oxidase complex. NCF2, NCF1, and a membrane bound cytochrome b558 are required for activation of the latent NADPH oxidase. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in NCF2 gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms.

    Referencias
  • Wientjes FB. et al., 1996, Semin Cell Biol. 6 (6): 357-65.
  • DeLeo FR. et al., 1997, J Leukoc Biol. 60 (6): 677-91.
  • Dorseuil O. et al., 1997, C R Seances Soc Biol Fil. 191 (2): 237-46.
  • Size / Price
    Catálogo: MG52449-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"