After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse NGF Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001112698.1
Tamaño de cDNA:726bp
Descripción de cDNA:Full length Clone DNA of Mus musculus nerve growth factor, transcript variant B with C terminal Myc tag.
Sinónimo de gen:Ngfb, Ngf
Especie:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta on other vectors
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50385-ACG$225
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50385-ACR$225
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50385-CF$195
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50385-CH$195
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50385-CM$195
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50385-CY$195
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(Vector de expresión)MG50385-M$75
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50385-NF$195
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50385-NH$195
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50385-NM$195
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50385-NY$195
Ratón NGF/NGFB/beta-NGF transcript variant B clonación del ADN o clonación génica(vector de clonación)MG50385-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Nerve growth factor (NGF) is important for the development and maintenance of the sympathetic and sensory nervous systems. NGF protein was identified as a large complex consisting of three non-covalently linked subunits, α, β, and γ, among which, the β subunit, called β-NGF (beta-NGF), was demonstrated to exhibits the growth stimulating activity of NGF protein. NGFB/beta-NGF gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. NGF protein acts via at least two receptors on the surface of cells (TrkA and p75 receptors) to regulate neuronal survival, promote neurite outgrowth, and up-regulate certain neuronal functions such as mediation of pain and inflammation. In addition, previous studies indicated that NGF may also have an important role in the regulation of the immune system.

Referencias
  • Castellanos MR, et al. (2003) Evaluation of the neurorestorative effects of the murine beta-nerve growth factor infusions in old rat with cognitive deficit. Biochem Biophys Res Commun. 312(4): 867-72.
  • Wang TH, et al. (2008) Effects of pcDNA3-beta-NGF gene-modified BMSC on the rat model of Parkinson's disease. J Mol Neurosci. 35(2): 161-9.
  • Perrard MH, et al. (2009) Redundancy of the effect of TGFbeta1 and beta-NGF on the second meiotic division of rat spermatocytes. Microsc Res Tech. 72(8): 596-602.
  • Size / Price
    Catálogo: MG50385-CM
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"