Pedido rápido

Ratón NUB1 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón NUB1 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_016736.2
    Tamaño de cDNA:1845bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus negative regulator of ubiquitin-like proteins 1.
    Sinónimo de gen:BS4, NY-REN-18, 4931404D21Rik, 6330412F12Rik
    Especie:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NUB1 qPCR primers for gene expression analysis, MP201257 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratón NUB1 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Product nameProduct name
    Size / Price
    Catálogo: MG51384-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"