OGN / Osteoglycin cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

OGN / Osteoglycin cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Mouse osteoglycin with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

OGN / Osteoglycin cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

3110079A16Rik cDNA ORF Clone, Mouse; mimecan cDNA ORF Clone, Mouse; mimican cDNA ORF Clone, Mouse; OG cDNA ORF Clone, Mouse; OIF cDNA ORF Clone, Mouse; SLRR3A cDNA ORF Clone, Mouse

OGN / Osteoglycin Background Information

OGN reduced Zeb-1 expression via EGFR/Akt leading to inhibition of epithelial-mesenchymal transition. In vitro and in vivo, the OGN expression was demonstrated to reduce cell proliferation, inhibit invasion of colon cancer cells then impede cancer progression. OGN plays a restrictive role in colorectal cancer progression by reduced activation of EGFR/AKT/Zeb-1.
Full Name
osteoglycin
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait