Pedido rápido

Ratón PD1/PDCD1/CD279 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PDCD1 Información de producto de clon de cDNA
Tamaño de cDNA:867bp
Descripción de cDNA:Full length Clone DNA of Mus musculus programmed cell death 1 with N terminal His tag.
Sinónimo de gen:PD-1, Pdc1, Ly101
Sitio de restricción:HindIII + NotI (6kb + 0.92kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse PDCD1 Gene Plasmid Map
Mouse PD1 / PDCD1 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón PD1/PDCD1/CD279 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Product nameProduct name

Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an immunoreceptor belonging to the CD28/CTLA-4 family negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase, SHP-2 upon interacting with either of two ligands, PD-L1 or PD-L2. PD1 inhibits the T-cell proliferation and production of related cytokines including IL-1, IL-4, IL-10 and IFN-γ by suppressing the activation and transduction of PI3K/AKT pathway. In addition, coligation of PD1 inhibits BCR-mediating signal by dephosphorylating key signal transducer. PD1 has been suggested to be involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. Furthermore, PD1 is shown to be a regulator of virus-specific CD8+ T cell survival in HIV infection. As a cell surface molecule, PDCD1 regulates the adaptive immune response. Engagement of PD-1 by its ligands PD-L1 or PD-L2 transduces a signal that inhibits T-cell proliferation, cytokine production, and cytolytic function.

  • James ES, et al. (2005) PDCD1: a tissue-specific susceptibility locus for inherited inflammatory disorders. Genes Immun. 6(5): 430-7.
  • Okazaki T, et al. (2007) PD-1 and PD-1 ligands: from discovery to clinical application. Int Immunol. 19(7): 813-24.
  • del Rio ML, et al. (2008) PD-1/PD-L1, PD-1/PD-L2, and other co-inhibitory signaling pathways in transplantation. Transpl Int. 21(11): 1015-28.
  • Riley JL.(2009) PD-1 signaling in primary T cells. Immunol Rev. 229(1): 114-25.
  • Size / Price
    Catálogo: MG50124-NH
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Mouse PD1 / PDCD1 natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.