Pedido rápido

Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PDE4B Información de producto de clon de cDNA
Tamaño de cDNA:1695bp
Descripción de cDNA:Full length Clone DNA of Mus musculus phosphodiesterase 4B, cAMP specific with N terminal His tag.
Sinónimo de gen:Dpde4; dunce; R74983
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51965-ACG$245
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51965-ACR$245
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51965-ANG$245
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51965-ANR$245
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51965-CF$215
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51965-CH$215
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51965-CM$215
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51965-CY$215
Mouse PDE4B Gene cDNA clone plasmidMG51965-G$75
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51965-NF$215
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51965-NH$215
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51965-NM$215
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51965-NY$215
Ratón PDE4B clonación del ADN o clonación génica(Vector de expresión)MG51965-U$75
Ratón PDE4B clonación del ADN o clonación génica(vector de clonación)MG51965-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

cAMP-specific 3',5'-cyclic phosphodiesterase 4B, also known as PDE4B and DPDE4, is a member of the cyclic nucleotide phosphodiesterase family. PDE4 subfamily. Cyclic nucleotide phosphodiesterases (PDEs) comprise a large family of enzymes that catalyze the hydrolysis of cAMP or cGMP and are implicated in various diseases. The crystal structures reveal a common scheme of inhibitor binding to the PDEs: (i) a hydrophobic clamp formed by highly conserved hydrophobic residues that sandwich the inhibitor in the active site; (ii) hydrogen bonding to an invariant glutamine that controls the orientation of inhibitor binding. A scaffold can be readily identified for any given inhibitor based on the formation of these two types of conserved interactions. These structural insights will enable the design of isoform-selective inhibitors with improved binding affinity and should facilitate the discovery of more potent and selective PDE inhibitors for the treatment of a variety of diseases. PDE4B / DPDE4 hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. It is expressed in brain, heart, lung and skeletal muscle. PDE4B / DPDE4 may be involved in mediating central nervous system effects of therapeutic agents ranging from antidepressants to antiasthmatic and anti-inflammatory agents

  • Bolger al., 1993, Mol. Cell. Biol. 13:6558-71.
  • Card al., 2004, Structure 12:2233-47.
  • Card al., 2005, Nat. Biotechnol. 23:201-7.
  • Wang al., 2007, Biochem. J. 408:193-201.
  • Hamblin J.N. et al., 2008, Bioorg. Med. Chem. Lett. 18: 4237-41. 
  • Size / Price
    Catálogo: MG51965-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.