After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PEBP1 Información de producto de clon de cDNA
Gene_bank_ref_id:AB046417.1
Tamaño de cDNA:564bp
Descripción de cDNA:Full length Clone DNA of Mus musculus phosphatidylethanolamine binding protein 1.
Sinónimo de gen:Pbp, HCNP, Pbp1, Pbpr, Rkip
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51347-ACG$225
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51347-ACR$225
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51347-ANG$225
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51347-ANR$225
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51347-CF$195
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51347-CH$195
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51347-CM$195
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51347-CY$195
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51347-NF$195
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51347-NH$195
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51347-NM$195
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51347-NY$195
Ratón PEBP1/RKIP clonación del ADN o clonación génica(Vector de expresión)MG51347-U$75
Ratón PEBP1/RKIP clonación del ADN o clonación génica(vector de clonación)MG51347-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: MG51347-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"