After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Periostin/POSTN/OSF-2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse POSTN Información de producto de clon de cDNA
Tamaño de cDNA:2436bp
Descripción de cDNA:Full length Clone DNA of Mus musculus periostin, osteoblast specific factor with N terminal Flag tag.
Sinónimo de gen:PN, Osf2, peri, OSF-2, AI747096, Periostin
Sitio de restricción:KpnI (two restriction sites) + XbaI (6kb+1.73kb+0.73kb)
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 471T/A, 1470T/C, 1494A/G, 1920T/C, 2238T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Mouse POSTN Gene Plasmid Map
Mouse POSTN natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón Periostin/POSTN/OSF-2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Size / Price
    Catálogo: MG50450-NF
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    • Mouse POSTN natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.