Pedido rápido

Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Ratón PPM1A Información de producto de clon de cDNA
Gene_bank_ref_id:NM_008910.2
Tamaño de cDNA:1149bp
Descripción de cDNA:Full length Clone DNA of Mus musculus protein phosphatase 1A, magnesium dependent, alpha isoform with N terminal His tag.
Sinónimo de gen:MMPa-2, MPPa-1, AI427932, AU017636, 2310003C21Rik, 2900017D14Rik, Ppm1a
Especie:Mouse
Vector:pCMV3-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with PPM1A qPCR primers for gene expression analysis, MP200301 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50277-ACG$225
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50277-ACR$225
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50277-ANG$225
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50277-ANR$225
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50277-CF$195
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50277-CH$195
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50277-CM$195
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50277-CY$195
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(Vector de expresión)MG50277-M$75
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50277-NF$195
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50277-NH$195
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50277-NM$195
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50277-NY$195
Ratón PPM1A/PP2CA clonación del ADN o clonación génica(vector de clonación)MG50277-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Protein phosphatase 1A (PPM1A / PP2CA) is an enzyme belonging to the PP2C family of Ser / Thr protein phosphatases. Members of PP2C family are negative regulators of cell stress response pathways and the MAP kinases and MAP kinase kinases. It has also been demonstrated to inhibit the activation of p38 and JNK kinase cascades. PPM1A dephosphorylates and promotes nuclear export of TGFβ-activated Smad2/3. Ectopic expression of PPM1A abolishes TGFβ-induced antiproliferative and transcriptional responses, whereas depletion of PPM1A enhances TGFβ signaling in mammalian cells. It has been demonstrated that PPM1A / PP2CA, through dephosphorylation of Smad2/3, plays a critical role in terminating TGFβ signaling. Overexpression of PPM1A is reported to activate the expression of the tumor suppressor gene TP53 / p53, which leads to cell apoptosis.

Referencias
  • Lin X, et al. (2006) PPM1A functions as a Smad phosphatase to terminate TGFbeta signaling. Cell. 125(5): 915-28.
  • Marc F, et al. (2003) Protein phosphatase 2C binds selectively to and dephosphorylates metabotropic glutamate receptor 3. Proc Natl Acad. 100 (26): 16006-11.
  • Mann DJ, et al. (1992) Mammalian protein serine/threonine phosphatase 2C: cDNA cloning and comparative analysis of amino acid sequences. Biochim Biophys Acta. 1130 (1): 100-4.
  • Size / Price
    Catálogo: MG50277-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"