Pedido rápido

Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PRDX1 Información de producto de clon de cDNA
Tamaño de cDNA:600bp
Descripción de cDNA:Full length Clone DNA of Mus musculus peroxiredoxin 1 with N terminal HA tag.
Sinónimo de gen:PAG, OSF3, Paga, PrxI, TDX2, TPxA, prx1, MSP23, NkefA, OSF-3, PrdxI, Tdpx2, Prdx1
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50552-ACG$225
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50552-ACR$225
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50552-ANG$225
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50552-ANR$225
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50552-CF$195
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50552-CH$195
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50552-CM$195
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50552-CY$195
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(Vector de expresión)MG50552-M$75
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50552-NF$195
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50552-NH$195
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50552-NM$195
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50552-NY$195
Ratón Peroxiredoxin 1/PRDX1 clonación del ADN o clonación génica(vector de clonación)MG50552-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Catálogo: MG50552-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.