Pedido rápido

Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PRDX2 Información de producto de clon de cDNA
Tamaño de cDNA:597bp
Descripción de cDNA:Full length Clone DNA of Mus musculus peroxiredoxin 2 with N terminal Flag tag.
Sinónimo de gen:TR; PRP; TPx; TSA; TDX1; NkefB; PrxII; TPx-B; Tdpx1; Torin; Band-8; AL022839
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG51862-ACG$225
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG51862-ACR$225
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG51862-ANG$225
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG51862-ANR$225
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG51862-CF$195
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG51862-CH$195
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG51862-CM$195
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG51862-CY$195
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(Vector de expresión)MG51862-G$75
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG51862-NF$195
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG51862-NH$195
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG51862-NM$195
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG51862-NY$195
Ratón Peroxiredoxin 2/PRDX2 clonación del ADN o clonación génica(vector de clonación)MG51862-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Peroxiredoxin-2, also known as Natural killer cell-enhancing factor B, NKEF-B, Thiol-specific antioxidant protein, Thioredoxin peroxidase 1, Thioredoxin-dependent peroxide reductase 1, PRDX2 and NKEFB, is a cytoplasm protein which belongs to the ahpC / TSA family. Peroxiredoxin-2 / PRDX2 contains one thioredoxin domain. Peroxiredoxin-2 / PRDX2 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-2 / PRDX2 is not able to receive electrons from glutaredoxin. It may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-2 / PRDX2 might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2.

The Peroxiredoxins / Prx are a family of peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

  • Cha M.-K., et al., 1995,  Biochem. Biophys. Res. Commun. 217:900-7.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Chevallet M., et al., 2003, J. Biol. Chem. 278:37146-53.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    Catálogo: MG51862-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.