After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PRDX5 Información de producto de clon de cDNA
Tamaño de cDNA:633bp
Descripción de cDNA:Full length Clone DNA of Mus musculus peroxiredoxin 5 with N terminal HA tag.
Sinónimo de gen:AOPP, PrxV, Pmp20, Prdx6, AOEB166, Prdx5
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50551-ACG$225
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50551-ACR$225
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50551-ANG$225
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50551-ANR$225
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50551-CF$195
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50551-CH$195
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50551-CM$195
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50551-CY$195
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(Vector de expresión)MG50551-M$75
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50551-NF$195
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50551-NH$195
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50551-NM$195
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50551-NY$195
Ratón Peroxiredoxin 5/PRDX5 clonación del ADN o clonación génica(vector de clonación)MG50551-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Peroxiredoxin-5, also known as Alu corepressor 1, Antioxidant enzyme B166, Liver tissue 2D-page spot 71B, Peroxisomal antioxidant enzyme, Thioredoxin peroxidase PMP20, Thioredoxin reductase, PRDX5 and ACR1, is cytoplasm protein which belongs to the?peroxiredoxin 2 family. Peroxiredoxin-5 / PRDX5 reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-5 / PRDX5 is involved in intracellular redox signaling. The Peroxiredoxins / Prx are a family of 25 kDa peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

  • Seo M.S., et al., 2000, J. Biol. Chem. 275: 20346-54.
  • Declercq J.-P., et al., 2001, J. Mol. Biol. 311:751-9.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Size / Price
    Catálogo: MG50551-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.