After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PREP Información de producto de clon de cDNA
Gene_bank_ref_id:NM_011156.2
Tamaño de cDNA:2133bp
Descripción de cDNA:Full length Clone DNA of Mus musculus prolyl endopeptidase.
Sinónimo de gen:PEP, AI047692
Especie:Mouse
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación) on other vectors
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50288-ACG$245
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50288-ACR$245
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50288-ANG$245
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50288-ANR$245
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50288-CF$215
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50288-CH$215
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50288-CM$215
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50288-CY$215
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(Vector de expresión)MG50288-M$75
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50288-NF$215
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50288-NH$215
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50288-NM$215
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50288-NY$215
Ratón Prolyl endopeptidase / PREP clonación del ADN o clonación génica(vector de clonación)MG50288-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

Referencias
  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"