After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PRKCI Información de producto de clon de cDNA
Gene_bank_ref_id:NM_008857.3
Tamaño de cDNA:1788bp
Descripción de cDNA:Full length Clone DNA of Mus musculus protein kinase C, iota with N terminal Myc tag.
Sinónimo de gen:Pkci, Pkcl, Prkcl, AI427505, KIAA4165, PKClambda, mKIAA4165, aPKClambda, 2310021H13Rik, Prkci
Especie:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), N-Myc Etiqueta on other vectors
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50788-ACG$245
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50788-ACR$245
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50788-ANG$245
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50788-ANR$245
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50788-CF$215
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50788-CH$215
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50788-CM$215
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50788-CY$215
Ratón PKC iota clonación del ADN o clonación génica(Vector de expresión)MG50788-G$75
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50788-NF$215
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50788-NH$215
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50788-NM$215
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50788-NY$215
Ratón PKC iota clonación del ADN o clonación génica(vector de clonación)MG50788-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Protein kinase C iota type, also known as Atypical protein kinase C-lambda/iota, aPKC-lambda/iota and PRKCI, is a cytoplasm, membrane and nucleus protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and PKC subfamily. PRKCI contains one AGC-kinase C-terminal domain, one OPR domain, one phorbol-ester/DAG-type zinc finger and one protein kinase domain. PRKCI is predominantly expressed in lung and brain, but also expressed at lower levels in many tissues including pancreatic islets. It is highly expressed in non-small cell lung cancers. PRKCI is a calcium-independent, phospholipid-dependent, serine- and threonine-specific kinase. It may play a role in the secretory response to nutrients. PRKCI is involved in cell polarization processes and the formation of epithelial tight junctions. It is implicated in the activation of several signaling pathways including Ras, c-Src and NF-kappa-B pathways. PRKCI functions in both pro- and anti-apoptotic pathways. It functions in the RAC1/ERK signaling required for transformed growth. PRKCI plays a role in microtubule dynamics through interaction with RAB2A and GAPDH and recruitment to vesicular tubular clusters (VTCs). PRKCI might be a target for novel lipid activators that are elevated during nutrient-stimulated insulin secretion.

Referencias
  • Selbie L.A. et al.,1993, J. Biol. Chem. 268:24296-302.
  • Diaz-Meco M.T. et al.,1996, Mol. Cell. Biol. 16:105-114.
  • Noda Y. et al.,2001, Genes Cells 6:107-119.
  • White W.O.et al.,2002, J. Cell. Biochem. 85:42-53.
  • Messerschmidt A. et al., 2005, J. Mol. Biol. 352:918-931.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"