Pedido rápido

Text Size:AAA

Ratón PRMT2 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Ratón PRMT2 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001077638.1
    Tamaño de cDNA:1338bp
    Descripción de cDNA:Full length Clone DNA of Mus musculus protein arginine N-methyltransferase 2.
    Sinónimo de gen:Hrmt1l1, AI504737
    Especie:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRMT2 qPCR primers for gene expression analysis, MP201249 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratón PRMT2 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Product nameProduct name
    Size / Price
    Catálogo: MG51376-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"