After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón PSPH clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PSPH Información de producto de clon de cDNA
Gene_bank_ref_id:NM_133900.4
Tamaño de cDNA:678bp
Descripción de cDNA:Full length Clone DNA of Mus musculus phosphoserine phosphatase with N terminal Flag tag.
Sinónimo de gen:PSP; PSPase; AI480570
Especie:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón PSPH clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name
Fondo

Phosphoserine phosphatase (PSPH) belongs to a subfamily of the phosphotransferases. PSPH is the rate-limiting enzyme in l-serine biosynthesis. It has previously been found that Phosphoserine phosphatase (PSPH) plays a role in epidermal homeostasis. Phosphoserine phosphatase (PSP) catalyzes the hydrolysis of phosphoserine to serine. Phosphoserine phosphatase (PSPH) expression has been examined in human-mouse somatic cell hybrids retaining different combination of human chromosomes. Phosphoserine phosphatase (PSPH) is expressed throughout the proliferative layer of the epidermis and hair follicles in rodent and human skin and is highly induced in SCC. In keratinocytes, Phosphoserine phosphatase (PSPH) is a cytoplasmic protein that primarily localizes to endosomes and is present primarily as a homodimer. Knock down of Phosphoserine phosphatase (PSPH) dramatically diminished SCC cell proliferation and cyclin D1 levels in the presence of exogenous of l-serine production suggesting a non-canonical role for Phosphoserine phosphatase (PSPH) in epithelial carcinogenesis. Phosphoserine phosphatase (PSPH) is highly induced in proliferative normal keratinocytes and in skin tumors. Phosphoserine phosphatase (PSPH) appears to be critical for the proliferation of SCC cells; however, this phenomenon may not involve the phosphoserine metabolic pathway.

Referencias
  • Bachelor MA, et al. (2011) L-3-Phosphoserine phosphatase (PSPH) regulates cutaneous squamous cell carcinoma proliferation independent of L-serine biosynthesis. J Dermatol Sci. 63(3): 164-72.
  • Koch GA, et al. (1983) Assignment of the human phosphoserine phosphatase gene (PSP) to the pter leads to q22 region of chromosome 7. Cytogenet Cell Genet. 35(1): 67-9.
  • Jaeken J, et al. (1997) Phosphoserine phosphatase deficiency in a patient with Williams syndrome. J Med Genet. 34(7): 594-6.
  • Size / Price
    Catálogo: MG51854-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"