Pedido rápido

Text Size:AAA

Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PTPN11 Información de producto de clon de cDNA
Tamaño de cDNA:1782bp
Descripción de cDNA:Full length Clone DNA of Mus musculus protein tyrosine phosphatase, non-receptor type 11, transcript variant 2 with N terminal Flag tag.
Sinónimo de gen:Syp, Shp2, PTP1D, PTP2C, SAP-2, SHP-2, SH-PTP2, SH-PTP3
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50462-ACG$245
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50462-ACR$245
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaMG50462-ANG$245
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaMG50462-ANR$245
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50462-CF$215
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50462-CH$215
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50462-CM$215
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50462-CY$215
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(Vector de expresión)MG50462-M$75
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50462-NF$215
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50462-NH$215
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50462-NM$215
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50462-NY$215
Ratón SHP2 / PTPN11 transcript variant 2 clonación del ADN o clonación génica(vector de clonación)MG50462-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.

  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • Size / Price
    Catálogo: MG50462-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.