PWP1 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

PWP1 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1506 bp
Description
Full length Clone DNA of Mouse PWP1 homolog (S. cerevisiae) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PWP1 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

2310058A11Rik cDNA ORF Clone, Mouse; 2610205J09Rik cDNA ORF Clone, Mouse; AI098170 cDNA ORF Clone, Mouse; AL022879 cDNA ORF Clone, Mouse; AV083409 cDNA ORF Clone, Mouse; AW550690 cDNA ORF Clone, Mouse

PWP1 Background Information

Full Name
PWP1 homolog, endonuclein
Add to Cart Successfully Add to Cart Failed