After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Ratón PGLYRP1/PGRP-S clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse PGLYRP1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_009402.2
Tamaño de cDNA:549bp
Descripción de cDNA:Full length Clone DNA of Mus musculus peptidoglycan recognition protein 1 with N terminal His tag.
Sinónimo de gen:PGRP, Tag7, Tasg7, PGRP-S, Pglyrp, Tnfsf3l
Especie:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratón PGLYRP1/PGRP-S clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Product nameProduct name
Fondo

Mouse Peptidoglycan recognition protein 1, also known as Peptidoglycan recognition protein short, PGRP-S, PGLYRP1, PGLYRP, PGRP and TNFSF3L, is a secreted protein which belongs to the N-acetylmuramoyl-L-alanine amidase 2 family. PGLYRP1 / PGLYRP is highly expressed in bone marrow. It is weakly expressed in kidney, liver, small intestine, spleen, thymus, peripheral leukocyte, lung, fetal spleen and neutrophils. PGLYRP1 / PGLYRP is a pattern receptor that binds to murein peptidoglycans (PGN) of Gram-positive bacteria. It has bactericidal activity towards Gram-positive bacteria. PGLYRP1 / PGLYRP may kill Gram-positive bacteria by interfering with peptidoglycan biosynthesis. It binds also to Gram-negative bacteria, and has bacteriostatic activity towards Gram-negative bacteria.

Peptidoglycan recognition proteins ( PGRPs or PGLYRPs ) are innate immunity proteins that are conserved from insects to mammals, recognize bacterial peptidoglycan, and function in antibacterial immunity and inflammation. Mammals have four PGRPs: PGLYRP1, PGLYRP2, PGLYRP3, and PGLYRP4. They are secreted proteins expressed in polymorphonuclear leukocytes ( PGLYRP1 ), liver ( PGLYRP2 ), or on body surfaces, mucous membranes, and in secretions (saliva, sweat) (PGLYRP3 and PGLYRP4). All PGRPs recognize bacterial peptidoglycan. The PGRPs likely play a role both in antibacterial defenses and several inflammatory diseases. They modulate local inflammatory responses in tissues (such as arthritic joints) and there is evidence for association of PGRPs with inflammatory diseases, such as psoriasis.

Size / Price
Catálogo: MG50115-NH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"